Poutanen “SARS-COV-1” Paper (2003)

The Poutanen study/report summarized the initial epidemiologic findings, clinical description, and diagnostic findings for the first probable cases of “SARS” in Canada. This paper was used along with three others as evidence that “SARS-COV-1” fulfilled Koch’s Postulates, a series of four logical requirements developed by Robert Koch in 1890 that were agreed upon by the scientific community as necessary to be satisfied in order to determine whether a new pathogen existed and caused disease. However, Poutanen et al fail miserably as there is no evidence presented of a properly purified/isolated “virus” taken directly from a sick patient nor is there any proof of pathogenicity whatsoever in this paper. On top of that, the researchers are unable to determine if it is a new “coronavirus,” a “metapneumovirus,” both of them, or some other unknown pathogen as the cause of “SARS.”

Below are highlights from the study. The paper itself is long so I edited out the sections focused on clinical diagnosis/symptoms as well as the epidemiological “evidence” presented in order to focus on the laboratory findings. Feel free to click the link below to the study/report if you are curious to read the rest:

Identification of Severe Acute Respiratory Syndrome in Canada

“The results of laboratory investigations were negative or not clinically significant except for the amplification of human metapneumovirus from respiratory specimens from five of nine patients and the isolation and amplification of a novel coronavirus from five of nine patients. In four cases both pathogens were isolated.

CONCLUSIONS

SARS is a condition associated with substantial morbidity and mortality. It appears to be of viral origin, with patterns suggesting droplet or contact transmission. The role of human metapneumovirus, a novel coronavirus, or both requires further investigation.

“Further virologic studies were completed on all respiratory specimens received from 9 of the 10 patients. These included viral cultures (including inoculation onto cell culture and into embryonated hen eggs and intracerebral inoculation of suckling mice), immune electron microscopy of nasopharyngeal swabs and bronchoalveolar fluids with serum obtained during the convalescent phase from Patient 10, RT-PCR for conserved portions of the polymerase gene of RNA viruses, and nested RT-PCR with genus-specific degenerative primers for paramyxoviruses and bunyaviruses. Results for all of these tests have been negative, with two exceptions. Human metapneumovirus was amplified by nested RT-PCR from bronchoalveolar-lavage fluid and nasopharyngeal swabs from five of nine patients with SARS and from a nasopharyngeal swab from an asymptomatic contact of one of the patients in Toronto (Patient 3) with use of the following primer pair: 5’CTTTGGACTTAATGACAGATG3′ and 5’GTCTTCCTGTGCTAACTTTG3′.4 For confirmation of these positive findings, the amplicons were sequenced and found to be unique, ruling out the possibility of cross-contamination in the laboratory.

In addition, a novel coronavirus was isolated from Vero cell cultures inoculated with respiratory specimens from five of nine patients with SARS. Four of these patients had specimens from which metapneumovirus was also identified. A cytopathic effect on the Vero cell cultures was noted on day 6 of incubation. On the basis of collaboration with investigators in Hong Kong and at the Centers for Disease Control and Prevention (CDC) in Atlanta, who reported isolating a novel coronavirus from patients with SARS in other areas of the world, RT-PCR was completed targeting conserved regions of the coronavirus polymerase gene using the following primer pair: 5’CAGAGCCATGCCTAACATG3′ and 5’AATGTTTACGCAGGTAAGCG3′. A novel coronavirus identical to that reported by the CDC2 was amplified from all five cultures. In addition, nested RT-PCR using the same primers plus 5’TGTTAAACCAGGTGGAAC3′ and 5’CCTGTGTTGTAGATTGCG3′ amplified the coronavirus directly from bronchoalveolar-lavage fluid from three of nine patients tested, all of whom also had coronavirus isolated from cell culture as described above.

At a different laboratory, a coronavirus was also identified independently by amplification directly from bronchoalveolar-lavage fluid from three of six patients tested. All three of these patients had coronavirus isolated from cell culture and amplification as described above. Reverse transcription was completed using the primer 5’GCATAGGCAGTAGTTGCATC3′, followed by PCR targeting a highly conserved region of the coronavirus polymerase gene with use of the primer pair 5’TGATGGGATGGGACTATCCTAAGTGTGA3′ and 5’TTGCATCACCACTAGTTGTGCCACCAGGTT3′. One of the amplicons was sequenced (GenBank accession number AY271716), and although the nucleotide sequence was different from that of any known coronaviruses, the deduced amino acid sequence had a high degree of homology (78 percent) to the polymerase amino acid sequence of several coronaviruses. Phylogenetic analysis suggests that this is a novel virus that is not closely related to any of the known clusters of coronaviruses (groups 1, 2, and 3).

Further studies are currently being completed to help determine whether the human metapneumovirus and a novel coronavirus, either alone or in combination, are the cause of SARS or whether other thus far undetected pathogens are possibly responsible. The possibility that coinfection of either virus with another agent may be responsible for SARS cannot be excluded.

Epidemiologic investigations and laboratory studies suggest that most patients with disease meeting the definition of SARS in both Toronto and Vancouver can be linked to a common source and to common potential causative agents. On the basis of preliminary investigations, it appears that this syndrome may be due in part to the newly described respiratory viral pathogen, human metapneumovirus,6 to a novel coronavirus, or both.

Evidence of the role of human metapneumovirus includes its amplification from respiratory specimens from five of nine Canadian patients with SARS and one asymptomatic contact and the identification of a metapneumovirus from respiratory specimens from other non-Canadian patients with SARS (Tam J, Department of Microbiology, Chinese University of Hong Kong: personal communication). In addition, the range of clinical findings, from asymptomatic disease to severe pneumonia and death, is similar to that described in human metapneumovirus infection.7 On the other hand, the severity with which the Canadian cases of SARS presented and the high attack rate of SARS among close contacts have not been described in patients with human metapneumovirus infection, suggesting that human metapneumovirus alone may not be responsible for SARS, that a genetic variant of the human metapneumovirus is potentially responsible, or that human metapneumovirus is not related to SARS but is an incidental finding. Indeed, we know little about the prevalence of asymptomatic carriage of human metapneumovirus, and such information would be helpful in interpreting the meaning of our amplification of this virus in patients meeting the criteria for SARS.8,9

The novel coronavirus identified in five of nine Canadian cases may also be a possible causative agent of SARS. Further evidence includes its identification by other investigators around the world from specimens from other patients with SARS and reports of positive immunofluorescence antibody tests in serum from patients from whom the coronavirus was isolated.2 In addition, known human coronaviruses are recognized to cause respiratory infection, albeit typically less severe than that described in the Canadian patients with SARS.10 Finally, coronaviruses are known to infect both animals and humans, and it is logical to consider that the emergence of a new disease may be related to the emergence of a novel coronavirus that originated with a limited range of animal hosts and evolved to involve an altered range that now includes humans.11 Although one can speculate about the possible roles of both coronaviruses and human metapneumovirus in SARS, it is currently not clear what role, if any, either of these viruses has in causing SARS. Further collaborative investigations are needed.

The mechanism of transmission of the agent or agents causing SARS is not yet understood. However, the fact that transmission has been limited to only close contacts of patients, such as household members, health care workers, or other patients who were not protected with contact or respiratory precautions, suggests that either droplet secretions or direct or indirect contact probably has a role.

“Treatment recommendations based on this small case series are obviously limited. However, given the possibility that human metapneumovirus or a coronavirus may be a possible causative agent and given the observed mortality rate, it may be prudent until there is further understanding of the underlying cause of SARS to consider empirical treatment with an antiviral agent, such as ribavirin.

https://www.nejm.org/doi/full/10.1056/NEJMoa030634

Hypothermia was a symptom of “SARS” in Canada?

In Summary:

Not only did Poutanen et al not prove “SARS-COV-1” as the cause of “SARS,” they make an even better case that it could be “metapneumoviruses.” Even then, the researchers state that they can not conclude whether it is the new “Coronavirus,” the “metapneumovirus,” both, neither, or some as of yet undiscovered agent that could be the cause of “SARS.” If there is one thing made clear from this study/report, it is that they were unable to determine anything at all.

2 comments

Leave a Reply

Discover more from ViroLIEgy

Subscribe now to keep reading and get access to the full archive.

Continue reading