Ksiazek “SARS-COV-1” Paper (2003)

This is the final of the four papers used to claim that Koch’s Postulates (four logic-based criteria needed to be met in order to claim a pathogen causes disease), were fulfilled for “SARS-COV-1.” However, as in the other papers used to make this claim, the researchers fail at even fulfilling the first two Postulates. The “virus” is not found in all cases of “SARS” nor is it ever properly purified/isolated directly from a sick host nor proven pathogenic. They use the same unpurified cell culture experiments as seen in every other “virus” paper and do not disclose the materials used during the culturing process. This study does try to implement many indirect serological and molecular techniques to prove a causative relationship (or association) between a novel “Coronavirus” and “SARS,” but these techniques (such as RT-PCR, immunohistochemical and immunofluorescence staining, as well as Indirect fluorescence antibody tests and enzyme-linked immunosorbent assays) are not requirements of Koch’s Postulates nor are they reliable measures to identify a “novel virus.” At best, they are all examples of highly questionable indirect evidence. Even then, the researchers admit to being unable to demonstrate “Coronavirus” antigens in patient tissues by histologic or immunohistochemical methods nor being able to prove direct involvement in the pathologic process. Highlights from the study are presented below:

A Novel Coronavirus Associated with Severe Acute Respiratory Syndrome

RESULTS

“None of the previously described respiratory pathogens were consistently identified. However, a novel coronavirus was isolated from patients who met the case definition of SARS. Cytopathological features were noted in Vero E6 cells inoculated with a throat-swab specimen. Electron-microscopical examination revealed ultrastructural features characteristic of coronaviruses. Immunohistochemical and immunofluorescence staining revealed reactivity with group I coronavirus polyclonal antibodies. Consensus coronavirus primers designed to amplify a fragment of the polymerase gene by reverse transcription–polymerase chain reaction (RT-PCR) were used to obtain a sequence that clearly identified the isolate as a unique coronavirus only distantly related to previously sequenced coronaviruses. With specific diagnostic RT-PCR primers we identified several identical nucleotide sequences in 12 patients from several locations, a finding consistent with a point-source outbreak. Indirect fluorescence antibody tests and enzyme-linked immunosorbent assays made with the new isolate have been used to demonstrate a virus-specific serologic response. This virus may never before have circulated in the U.S. population.”

Methods

GENERAL APPROACH

The nonspecific nature of the clinical presentation of patients with SARS and the urgency of finding a cause required that clinical specimens be tested rapidly for a broad range of viral, bacterial, chlamydial, and rickettsial agents (the CDC case definition of SARS is available as Supplementary Appendix 1 with the full text of this article at http://www.nejm.org). Laboratory testing focused foremost on known respiratory pathogens, especially those that might specifically target the lower respiratory tract through the progression of disease. A combination of traditional methods was applied, including virus isolation in suckling mice and cell culture, electron microscopy, histopathological examination, serologic analysis, and general and specialized bacterial culture techniques. The molecular techniques of polymerase chain reaction (PCR), reverse-transcription PCR (RT-PCR), and real-time PCR were used. Priority was given to testing for the following agents: yersinia, mycoplasma, chlamydia, legionella, Coxiella burnetii, spotted fever and typhus group rickettsiae, influenzaviruses A and B, Paramyxovirinae and Pneumovirinae subfamily viruses (specifically, human respiratory syncytial virus and human metapneumovirus), Mastadenoviridae, Herpetoviridae, Picornaviridae, Old and New World hantaviruses, and Old World arenaviruses.

BIOSAFETY

“Given the serious nature of SARS and the suggestion of person-to-person transmission, it was decided to handle all clinical specimens in a biosafety level 3 environment.”

ISOLATION OF VIRUS

To identify viruses associated with SARS, we inoculated a variety of clinical specimens (blood, serum, material from oropharyngeal swabs or washings, material from nasopharyngeal swabs, and tissues of major organs collected at autopsy) onto a number of continuous cell lines, including Vero E6, NCI-H292, MDCK, LLC-MK2, and B95-8 cells, and into suckling ICR mice by the intracranial and intraperitoneal routes. All cultures were observed daily for cytopathic effect. Maintenance medium was replenished at day 7, and cultures were terminated 14 days after inoculation. Any cultures exhibiting identifiable cytopathic effect were subjected to several procedures to identify the cause of the effect. Suckling mice were observed daily for 14 days, and we further tested any sick or dead mice by preparing a brain suspension that was filtered and subcultured. Mice that remained well after 14 days were euthanized, and their test results were recorded as negative. Tissue-culture samples showing cytopathic effect were prepared for electron-microscopical examination. Negative-stain electron-microscopical specimens were prepared by drying culture supernatant, mixed 1:1 with 2.5 percent paraformaldehyde, onto Formvarcarbon-coated grids and staining with 2 percent methylamine tungstate. Thin-section electron-microscopical specimens were prepared by fixing a washed cell pellet with 2.5 percent glutaraldehyde and embedding it in epoxy resin. For RT-PCR assays, cell-culture supernatants were placed in lysis buffer. In addition, a master seed was prepared from the remaining culture supernatant and cells by freeze-thawing the culture flask, clarifying the thawed contents by centrifugation at 1000×g, and dispensing the supernatant into aliquots stored in gas phase over liquid nitrogen. The master seed was subcultured into 850-cm2 roller bottles of Vero E6 cells for the preparation of formalin-fixed positive control cells for immunohistochemical analysis, mixed with normal E6 cells, and gamma-irradiated for preparation of spot slides for indirect fluorescence antibody tests or extracted with detergent and gamma-irradiated for use as an enzyme-linked immunosorbent assay (ELISA) antigen for antibody tests.”

“We used the following antibody and tissue controls: serum specimens from noninfected animals, various coronavirus-infected cell cultures and animal tissues, noninfected cell cultures, and normal human and animal tissues. Tissues from patients were also tested by immunohistochemical assays for various other viral and bacterial pulmonary pathogens. In addition, a bronchoalveolar-lavage specimen was available from one patient with SARS for thin-section electron-microscopical evaluation.

MOLECULAR ANALYSES

RNA extracts were prepared from 100 μl of each specimen (or culture supernatant) with the automated NucliSens extraction system (bioMérieux). Oligonucleotide primers used for amplification and sequencing of the SARS-related coronavirus were designed from alignments of open reading frame 1b of the coronavirus polymerase gene sequences obtained from GenBank, including human coronaviruses 229E and OC43 (accession numbers X69721 and AF124989, respectively), canine coronavirus (AF124986), feline infectious peritonitis virus (AF124987), porcine transmissible gastroenteritis virus (Z34093), porcine epidemic diarrhea virus (NC_003436), bovine coronavirus (NC_003045), porcine hemagglutinating encephalomyelitis virus (AF124988), sialodacryoadenitis virus (AF124990), mouse hepatitis virus (NC_001846), turkey coronavirus (AF124991), and avian infectious bronchitis virus (NC_001451). Primer pair IN-2 (+) 5’GGGTT-GGGACTATCCTAAGTGTGA3′ and IN-4 (–) 5’TAACACACAACICCATCATCA3′ was previously designed to conserved regions of open reading frame 1b to achieve broad reactivity with the genus coronavirus. These primers were used to amplify DNA from SARS isolates, and the amplicon sequences obtained were used to design SARS-specific primers Cor-p-F2 (+) 5’CTAACATGCTTAGGATAATGG3′, Cor-p-F3 (+) 5’GCCTCTCTTGTTCTTGCTCGC3′, and Cor-p-R1 (–) 5’CAGGTAAGCGTAAAACTCATC3′, which were used in turn to test patient specimens.

Results

Lots of RT-PCR Positives, very few serologic positives nor “virus isolation” successes.

VIRUS ISOLATION

Two cell lines, Vero E6 cells and NCI-H292 cells, inoculated with oropharyngeal specimens from Patient 16 (a 46-year-old male physician with an epidemiologic link to a hospital with multiple patients with SARS) initially showed cytopathic effect (Table 1). Blood, nasopharyngeal, and throat-swab specimens were collected on March 12, day 1 after onset. At that time, the patient’s physical examination was normal except for fever and shortness of breath. During the course of the disease, his status worsened, and he died. A rhinovirus was isolated from the inoculated NCI-H292 cells. Further study suggested that this virus was not associated with patients with SARS, so it will not be discussed here.

Typical early CPE in Vero Cells in Fig A and reaction to fluorescence antibody assay in Vero cells in Fig B.

Cytopathic effect in the Vero E6 cells was first noted on the fifth post-inoculation day. The cytopathic effect was focal, with cell rounding and a refractive appearance in the affected cells (Figure 1) that was soon followed by cell detachment. The cytopathic effect quickly spread to involve the entire cell monolayer within 24 to 48 hours. Subculture of material after preparation of a master seed resulted in the rapid appearance of cytopathic effect, as noted above, and in complete destruction of the monolayer in the inoculated flasks within 48 hours.”

Unpurified particles picked as the representation of “Coronaviruses.”

Examination of cytopathic-effect–positive Vero E6 cells by thin-section electron microscopy revealed characteristic coronavirus particles within the cisternae of the rough endoplasmic reticulum and in vesicles (Figure 2A).14,15 Extracellular particles were found in large clusters and adhering to the surface of the plasma membrane. Negative-stain electron microscopy identified coronavirus particles, 80 to 140 nm in diameter, with 20-to-40-nm complex surface projections surrounding the periphery (Figure 2B). Hemagglutinin esterase-type glycoprotein projections were not seen.


Figure 4. Histopathological Evaluation of Lung Tissue from a Patient with SARS and Immunohistochemical Staining of Vero E6 Culture Cells Infected with SARS-Associated Coronavirus.

Panel A shows diffuse alveolar damage, abundant foamy macrophages, and multinucleated syncytial cells. Panel B shows a higher magnification of a pulmonary syncytial cell with no conspicuous viral inclusions. Panel C shows immunohistochemical staining of SARS-associated coronavirus–infected culture cells. Membranous and cytoplasmic immunostaining of individual and syncytial Vero E6 cells is demonstrated with a cat anti–feline infectious peritonitis virus 1 ascitic fluid. 

“Lung tissues were obtained at autopsy from three patients and by open-lung biopsy in one patient, 14 to 19 days after the onset of SARS. Confirmatory laboratory evidence of infection with coronavirus was available for two patients (Patients 6 and 17) and included PCR amplification of coronavirus nucleic acids from tissues, viral isolation from bronchoalveolar-lavage fluid, or detection of serum antibodies reactive with coronavirus (Table 1). For two patients, no samples were available for molecular, cell-culture, or serologic analysis; however, the condition of both patients met the CDC definition of probable SARS, and both had strong epidemiologic links with laboratory-confirmed cases of SARS.”

No obvious intranuclear or intracytoplasmic viral inclusions were identified (Figure 4B), and electron-microscopical examination of a limited number of these syncytial cells revealed no coronavirus particles. No definitive immunostaining was identified in tissues from SARS patients with the use of a battery of immunohistochemical stains reactive with coronaviruses from antigenic groups I, II, and III.”

EM images from unpurified BALF of one patient.

Evaluation of Vero E6 cells infected with coronavirus isolated from a patient with SARS revealed viral cytopathic effect that included occasional multinucleated syncytial cells but no obvious viral inclusions (Figure 4C). Immunohistochemical assays with various antibodies reactive with coronaviruses from antigenic group I, including human coronavirus 229E, feline infectious peritonitis virus 1, and porcine transmissible gastroenteritis virus, and with an immune serum specimen from a patient with SARS demonstrated strong cytoplasmic and membranous staining of infected cells (Figure 4C and Table 2); however, cross-reactivity with the same immune human serum sample and feline infectious peritonitis virus 1 antigen was not observed. No staining was identified with any of several monoclonal or polyclonal antibodies reactive with coronaviruses in antigenic group II (human coronavirus OC43, bovine coronavirus, and mouse hepatitis virus) or group III (turkey coronavirus and avian infectious bronchitis virus). Electron-microscopical examination of bronchoalveolar-lavage fluid from one patient revealed many coronavirus-infected cells (Figure 5).”

PATIENTS

Nineteen patients with SARS have been identified as infected with the new coronavirus by virus isolation, RT-PCR, or serologic tests; all have direct or indirect links to the SARS outbreak in Hong Kong or Guangdong Province, China (Table 1). We were able to amplify by RT-PCR and obtain the virus sequence from clinical specimens or virus isolates from 12 of these patients. All 12 sequences were identical to those of the first isolate as noted above. For four convalescent patients, infection was detected serologically alone; for nine patients it was detected by RT-PCR alone; for three by virus isolation and RT-PCR; for two by virus isolation, RT-PCR, and serologic analysis; and for one by RT-PCR and serologic analysis. We found none of the coronavirus-infected patients to be infected with human metapneumovirus. In only one patient was both SARS coronavirus and another respiratory virus detected; Patient 16 had both SARS coronavirus and a rhinovirus. A variety of respiratory pathogens were also identified by RT-PCR in other patients whose samples were submitted for SARS testing, including 5 with human metapneumoviruses (sequencing showed that each was distinct) and 12 with rhinoviruses (sequencing showed that each was distinct). None of the patients who were positive for human metapneumovirus had pneumonia.”

Discussion

“The isolation of a novel coronavirus from the respiratory secretions of a patient with SARS and the subsequent demonstration of this virus or a serologic response to this virus in others with SARS demonstrate an etiologic association between this virus and SARS.”

The three known groups of coronavirus are associated with a variety of diseases of humans and domestic animals, including gastroenteritis and upper and lower respiratory tract disease. Although the known human coronaviruses are associated with a mild disease (the common cold), the ability of coronavirus of animals to cause severe disease raises the possibility that coronavirus could also cause more severe disease in humans. Other than rare instances in children or immunocompromised patients, it appears that the SARS-related coronavirus may be the first example of a coronavirus that causes severe disease in humans. The novel human coronavirus identified in this study shares antigenic features with various group I coronaviruses, but genetic comparisons suggest it is distinct from group I coronaviruses and from coronaviruses in groups II and III. The factor or factors responsible for this apparent dichotomy remain to be elucidated; however, correlation between antigenic and genetic characteristics of these viruses is occasionally unclear, and the placement of some other human coronaviruses within specific antigenic groups has not always been well defined.18-20.

The identification of this novel coronavirus relied on classic tissue-culture isolation to amplify the pathogen and then on electron-microscopical studies to identify the type of virus, a member of the family Coronaviridae, and molecular studies to confirm the identity of the virus, characterize its unique nature, and help link it to the disease. The discovery of this new virus underscores the importance of versatile techniques such as virus isolation and electron microscopy in identifying etiologic pathogens. As with previous outbreak investigations, electron microscopy proved to be a rapid technique that did not require specific reagents for or prior knowledge of a particular agent but that could nevertheless categorize a pathogen on the basis of its appearance and morphogenesis.21-24

“We were not, however, able to demonstrate coronavirus antigens in patient tissues by histologic and immunohistochemical methods or to demonstrate a direct involvement in the pathologic process. Neither were we able to demonstrate SARS-associated coronavirus infection in all suspected patients with SARS.

Possible reasons for the inability to demonstrate infection in some patients with suspected SARS include the lack of sufficient sensitivity of the assays to detect the pathogen and the immune response and the timing and type of specimens tested. For example, we have not yet received convalescent-phase serum specimens from many patients with suspected SARS and have not serologically ruled out infection in many such patients. In addition, we are just beginning to study the type and timing of clinical specimens most likely to support a diagnosis of infection with this new virus. We have made rapid progress in developing our diagnostic assays and are continuing to improve them for the detection of this virus or an immune response to it. In addition, the case definition of SARS is very broad and most likely includes other infectious diseases. We are also continuing to test for other infectious agents that might be associated with SARS, including those that might contribute to the severity of disease or increase the efficiency of viral transmission. Further clinical analysis of patients with SARS in whom there is laboratory confirmation of infection with the new coronavirus might help refine the case definition further.

The isolation and growth of a human-derived coronavirus in Vero E6 cells were unexpected. The only human or animal coronavirus that has been shown to grow in Vero cells is porcine epidemic diarrhea virus (isolated in China from pigs), and it requires the addition of trypsin to culture medium for growth in Vero E6 cells.25 However, like the sequences of the other known coronaviruses, the sequences for porcine epidemic diarrhea virus are distinct from those of SARS-associated coronavirus, indicating that porcine epidemic diarrhea virus is not the parent virus to this new coronavirus. Because of the death of Dr. Carlo Urbani during the investigation, we propose that our first isolate be named the Urbani strain of SARS-associated coronavirus.

Pathological studies in patients who died with SARS show diffuse alveolar damage as the most notable feature, a finding consistent with the severe respiratory illness seen in some patients with SARS. The primary histopathological lesions seen in the lungs of four patients we studied are consistent with a nonspecific response to acute lung injury that can be caused by infectious agents, trauma, drugs, or toxic chemicals. However, the multinucleated syncytial cells without viral inclusions seen in the lungs of two patients, including one patient positive by PCR, serologic, and virus-isolation methods, are suggestive of a number of viral infections, including measles and parainfluenzavirus, respiratory syncytial virus, and Nipah virus infection. Syncytia have occasionally been observed in culture cells inoculated with other group I and II coronaviruses that infect humans,26-28 but they are more often described in culture cells infected with animal coronaviruses.29-31 To our knowledge, syncytial cells have not been previously described in human tissues infected with coronaviruses.

We did not detect antigens of viruses associated with syncytial formation or SARS-associated coronavirus in these patient tissues, despite the severe pulmonary pathological processes. To detect this novel coronavirus antigen, we used an extensive panel of antibodies against coronaviruses representative of the three antigenic groups. The failure of these antiserum specimens to react with coronavirus antigens in the lung tissues of these patients could be attributed to clearance of viral antigens by the host immune response during the late stage of disease.”

It is also possible that the pulmonary damage associated with SARS is not caused directly by the virus but represents a secondary effect of cytokines or other factors induced by viral infection proximal to but not within the lung tissue.”

https://www.nejm.org/doi/full/10.1056/nejmoa030781

Beautifully colored “SARS-COV-1” (image not from this study).

In Summary:

Quick side note on Master Seed. Below is the legal definition:

Master Seed means the following (other than Retained Master Seed): (i) the isolated strain of organism selected and permanently stored by Respondent from which all other seed passages are derived within permitted levels for each Divestiture Product and (ii) the isolated strain of organism for the Divestiture Products produced by, and permanently stored by, Respondent from master seed identical to the seed set forth in clause (i) from which all other seed passages are derived within permitted levels for each Divestiture Product.”

https://www.lawinsider.com/dictionary/master-seed

In other words, this is the unpurified “virus” stock that is subcultured to create more “virus” in order to be used for testing and vaccines. These are further alterations done to the original sample after having gone through the toxic cell culture process originally. According to the Ksiazek study, this is what was done to the master seed stock:

“The master seed was subcultured into 850-cm2 roller bottles of Vero E6 cells for the preparation of formalin-fixed positive control cells for immunohistochemical analysis, mixed with normal E6 cells, and gamma-irradiated for preparation of spot slides for indirect fluorescence antibody tests or extracted with detergent and gamma-irradiated for use as an enzyme-linked immunosorbent assay (ELISA) antigen for antibody tests.”

As stated earlier, the researchers failed to provide evidence of a purified/isolated “virus” taken directly from a sick patient which is then proven pathogenic in a natural way. At least they admit they were unable to show “SARS-COV-1” in all “SARS” patients thus failing Koch’s first Postulate invalidating this whole study as proof that the Postulates have been fulfilled. The researchers also admit they are continuing to look for other infectious agents as the possible cause of “SARS,” further disqualifying this study as proof. If the logical criteria required to prove a pathogen causes disease need to be reworked, rewritten, and/or skirted around in order to claim that they have been satisfied, it is clear that this is not the case. This paper fails the very basics.

3 comments

Leave a Reply

Discover more from ViroLIEgy

Subscribe now to keep reading and get access to the full archive.

Continue reading